ACL_RS00495
  | Uniprot: A9NEE6
Description: 30S ribosomal protein S14 EC number: Annotation score: 2 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: FUNCTION: Binds 16S rRNA, required for the assembly of 30S particles and may also be responsible for determining the conformation of the 16S rRNA at the A site. {ECO:0000255|HAMAP-Rule:MF_00537}. Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpsN Gene names (synonym): Mass: 10,157 Subunit structure [CC]: SUBUNIT: Part of the 30S ribosomal subunit. Contacts proteins S3 and S10. {ECO:0000255|HAMAP-Rule:MF_00537}. Gene ontology (GO): ribosome [GO:0005840]; rRNA binding [GO:0019843]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0005840; GO:0006412; GO:0019843 Chain: CHAIN 1 89 30S ribosomal protein S14. /FTId=PRO_1000128272. Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein S14P family. {ECO:0000255|HAMAP-Rule:MF_00537}. Protein families: Ribosomal protein S14P family Coiled coil: Domain [FT]: Motif: Region: EMBL: CP000896 ProteinModelPortal: A9NEE6 MEROPS: EnsemblBacteria KO: ABX80726 UniPathway: K02954 CDD: Gene3D: HAMAP: InterPro: MF_00537 PANTHER: IPR001209;IPR023036 PIRSF: PTHR19836 PRINTS: PROSITE: Pfam: ProDom: PF00253 SMART: SUPFAM: TIGRFAMs: |
90468-90738(+) >nucleotide sequence GCTGAAAAACGTAGAGCTTTGAAAGAAGCTGGAGATTACCAAGGTTTATCTAGTCTACCA AAAGATGCATCACCGGTAAGATTAAGAAATAGAGATTCATTAGACGGTAGACCAAGAGCA TATATGAGAAAATTCGGTGTATCTCGTATAACATTCAGAGAATTAGCACACAAGGGAGAA ATTCCTGGTGTTAAAAAAGCTAGCTGGTAA >protein sequence YMRKFGVSRITFRELAHKGEIPGVKKASW |
© Fisunov Lab of Proteomics, 2016.