ACL_RS00520
  | Uniprot: A9NEF1
Description: 50S ribosomal protein L30 EC number: Annotation score: 2 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpmD Gene names (synonym): Mass: 6,248 Subunit structure [CC]: SUBUNIT: Part of the 50S ribosomal subunit. {ECO:0000255|HAMAP-Rule:MF_01371}. Gene ontology (GO): large ribosomal subunit [GO:0015934]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0006412; GO:0015934 Chain: CHAIN 1 57 50S ribosomal protein L30. /FTId=PRO_0000347068. Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein L30P family. {ECO:0000255|HAMAP-Rule:MF_01371}. Protein families: Ribosomal protein L30P family Coiled coil: Domain [FT]: Motif: Region: EMBL: CP000896 ProteinModelPortal: A9NEF1 MEROPS: EnsemblBacteria KO: ABX80731 UniPathway: K02907 CDD: Gene3D: HAMAP: 3.30.1390.20 InterPro: MF_01371_B PANTHER: IPR005996;IPR016082 PIRSF: PRINTS: PIRSF002211 PROSITE: Pfam: ProDom: PF00327 SMART: SUPFAM: TIGRFAMs: SSF55129 |
92592-92766(+) >nucleotide sequence GCTCACGCACTCGGTTTAAGAAAAATTGGACAAAGTGTTTCAAAAGTAGAAAATGACGCT ATCAACGGAATGATCAACACAATTGGTCACCTAGTTGTAGTGGAAAAAGAATAA >protein sequence |
© Fisunov Lab of Proteomics, 2016.