ACL_RS01525
  | Uniprot: A9NEZ7
Description: DNA-directed RNA polymerase subunit omega EC number: 2.7.7.6 Annotation score: 2 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: CATALYTIC ACTIVITY: Nucleoside triphosphate + RNA(n) = diphosphate + RNA(n+1). {ECO:0000256|HAMAP-Rule:MF_00366, ECO:0000256|SAAS:SAAS00094481}. Cofactor: Enzyme regulation: Function [CC]: FUNCTION: Promotes RNA polymerase assembly. Latches the N- and C-terminal regions of the beta' subunit thereby facilitating its interaction with the beta and alpha subunits. {ECO:0000256|HAMAP-Rule:MF_00366, ECO:0000256|SAAS:SAAS00366146}. Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpoZ Gene names (synonym): Mass: 7,960 Subunit structure [CC]: SUBUNIT: The RNAP catalytic core consists of 2 alpha, 1 beta, 1 beta' and 1 omega subunit. When a sigma factor is associated with the core the holoenzyme is formed, which can initiate transcription. {ECO:0000256|HAMAP-Rule:MF_00366, ECO:0000256|SAAS:SAAS00366140}. Gene ontology (GO): DNA binding [GO:0003677]; DNA-directed RNA polymerase activity [GO:0003899]; transcription, DNA-templated [GO:0006351] Gene ontology IDs: GO:0003677; GO:0003899; GO:0006351 Chain: Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the RNA polymerase subunit omega family. {ECO:0000256|HAMAP-Rule:MF_00366, ECO:0000256|SAAS:SAAS00573536}. Protein families: RNA polymerase subunit omega family Coiled coil: Domain [FT]: Motif: Region: EMBL: CP000896 ProteinModelPortal: MEROPS: EnsemblBacteria KO: ABX80927 UniPathway: K03060 CDD: Gene3D: HAMAP: 3.90.940.10 InterPro: MF_00366 PANTHER: IPR003716;IPR006110;IPR012293 PIRSF: PRINTS: PROSITE: Pfam: ProDom: PF01192 SMART: SUPFAM: SM01409 TIGRFAMs: SSF63562 |
314610-314826(+) >nucleotide sequence GATTCTAAGTATAAATTAGTATATGCAGCGAGTAAAGTTGCTCATATCATTGAAAGAGAA AATTTGGATGTTAAAGATTCCAAATCAGTCACAAGTGTAGGCAAAGCGTTAGAAGAAATT GCAAATGGTAAAGTAACTGTTACGTTCATTGACTAA >protein sequence ANGKVTVTFID |
© Fisunov Lab of Proteomics, 2016.