ACL_RS04710
  | Uniprot: A9NGT2
Description: 30S ribosomal protein S21 EC number: Annotation score: 1 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpsU Gene names (synonym): Mass: 6,999 Subunit structure [CC]: Gene ontology (GO): ribosome [GO:0005840]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0005840; GO:0006412 Chain: CHAIN 1 59 30S ribosomal protein S21. /FTId=PRO_1000079395. Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein S21P family. {ECO:0000255|HAMAP-Rule:MF_00358}. Protein families: Ribosomal protein S21P family Coiled coil: Domain [FT]: Motif: Region: EMBL: CP000896 ProteinModelPortal: A9NGT2 MEROPS: EnsemblBacteria KO: ABX81562 UniPathway: K02970 CDD: Gene3D: HAMAP: InterPro: MF_00358 PANTHER: IPR001911 PIRSF: PRINTS: PROSITE: PR00976 Pfam: ProDom: PF01165 SMART: PD005521 SUPFAM: TIGRFAMs: |
977289-977469(-) >nucleotide sequence TTTAATATAATATTCGCGTTTACGAGCCTCTACGAGAGTTCCATCTTTACTTACGGTGCG CTTAAAACGACGTAGTGTATCTTCTATCGTCTCACCTTTACGTACTTCTGTTTTAGACAT >protein sequence |
© Fisunov Lab of Proteomics, 2016.