ACL_RS07090
  | Uniprot: A9NE64
Description: 50S ribosomal protein L34 EC number: Annotation score: 1 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpmH Gene names (synonym): Mass: 5,205 Subunit structure [CC]: Gene ontology (GO): ribosome [GO:0005840]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0005840; GO:0006412 Chain: CHAIN 1 44 50S ribosomal protein L34. /FTId=PRO_1000080237. Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein L34P family. {ECO:0000255|HAMAP-Rule:MF_00391}. Protein families: Ribosomal protein L34P family Coiled coil: Domain [FT]: Motif: Region: EMBL: CP000896 ProteinModelPortal: A9NE64 MEROPS: EnsemblBacteria KO: ABX82024 UniPathway: K02914 CDD: Gene3D: HAMAP: InterPro: MF_00391 PANTHER: IPR000271;IPR020939 PIRSF: PTHR14503 PRINTS: PROSITE: Pfam: PS00784 ProDom: PF00468 SMART: PD003101 SUPFAM: TIGRFAMs: |
1496757-1496892(-) >nucleotide sequence AGCAGTAGCCATACGAGCTCTAAATCCGTGCCTTCTTTGATGTTTGATTTTACTTGGTTG ATATGTTCTTTTCAT >protein sequence |
© Fisunov Lab of Proteomics, 2016.