GCW_00300
![]() ![]() ![]() |
Uniprot: A0A0F6CJV8
Description: 30S ribosomal protein S19 EC number: Annotation score: 2 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: FUNCTION: Protein S19 forms a complex with S13 that binds strongly to the 16S ribosomal RNA. {ECO:0000256|HAMAP-Rule:MF_00531}. Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpsS Gene names (synonym): Mass: 9,979 Subunit structure [CC]: Gene ontology (GO): small ribosomal subunit [GO:0015935]; rRNA binding [GO:0019843]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0006412; GO:0015935; GO:0019843 Chain: Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein S19P family. {ECO:0000256|HAMAP-Rule:MF_00531, ECO:0000256|RuleBase:RU003485}. Protein families: Ribosomal protein S19P family Coiled coil: Domain [FT]: Motif: Region: EMBL: CP006916 ProteinModelPortal: A0A0F6CJV8 MEROPS: EnsemblBacteria KO: AHB99380 UniPathway: K02965 CDD: Gene3D: HAMAP: 3.30.860.10 InterPro: MF_00531 PANTHER: IPR002222;IPR005732;IPR020934;IPR023575 PIRSF: PTHR11880 PRINTS: PIRSF002144 PROSITE: PR00975 Pfam: PS00323 ProDom: PF00203 SMART: SUPFAM: TIGRFAMs: SSF54570 70669-70933(+) >nucleotide sequence GACATGAATGCACAACAAAAAAAGAAAATAATCAAGACTTGATCTAGAAGAAGTACTATT TTTCCAGATTTTGTTGGTCACACTTTTGCTGTTCATAATGGTAAGAAATTCATTAACGTT TATGTAACTGAAGATATGATCGGTCACAAACTAGGTGAATTTTCTCCTACAAGAACATTT AAAGGACACAGTTCTAACAGATAG >protein sequence YVTEDMIGHKLGEFSPTRTFKGHSSNR |
© Fisunov Lab of Proteomics, 2016.