GCW_00325
![]() ![]() ![]() |
Uniprot: A0A0F6CJW3
Description: 30S ribosomal protein S17 EC number: Annotation score: 2 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: FUNCTION: One of the primary rRNA binding proteins, it binds specifically to the 5'-end of 16S ribosomal RNA. {ECO:0000256|HAMAP-Rule:MF_01345, ECO:0000256|SAAS:SAAS00316154}. Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpsQ Gene names (synonym): Mass: 9,879 Subunit structure [CC]: SUBUNIT: Part of the 30S ribosomal subunit. {ECO:0000256|HAMAP-Rule:MF_01345, ECO:0000256|SAAS:SAAS00544036}. Gene ontology (GO): ribosome [GO:0005840]; rRNA binding [GO:0019843]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0005840; GO:0006412; GO:0019843 Chain: Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein S17P family. {ECO:0000256|HAMAP-Rule:MF_01345, ECO:0000256|RuleBase:RU003872, ECO:0000256|SAAS:SAAS00544057}. Protein families: Ribosomal protein S17P family Coiled coil: Domain [FT]: Motif: Region: EMBL: CP006916 ProteinModelPortal: A0A0F6CJW3 MEROPS: EnsemblBacteria KO: AHB99385 UniPathway: K02961 CDD: Gene3D: HAMAP: 2.40.50.140 InterPro: MF_01345_B PANTHER: IPR012340;IPR000266;IPR019984;IPR019979 PIRSF: PTHR10744 PRINTS: PROSITE: PR00973 Pfam: PS00056 ProDom: PF00366 SMART: PD001295 SUPFAM: TIGRFAMs: SSF50249 73060-73318(+) >nucleotide sequence GCTACTGTAAAGGTTGAGTCAAAAAACAGACACCCTTTTTATCACAAGTTGGTAATTTCT CACAAGAAGTATCACGTTCACAACGAAGAAGGTGAAAATGCCGCTAAAGTTGGTGACAAA GTGTTGATTATGGAAACTCGCCCATTATCAGCAACTAAGCGTTGAAGAATTGCTAAGATT ATAGAACGAGCTAAATAA >protein sequence VLIMETRPLSATKRWRIAKIIERAK |
© Fisunov Lab of Proteomics, 2016.