GCW_00445
![]() ![]() ![]() |
Uniprot: A0A0F6CJY3
Description: 30S ribosomal protein S15 EC number: Annotation score: 2 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: FUNCTION: Forms an intersubunit bridge (bridge B4) with the 23S rRNA of the 50S subunit in the ribosome. {ECO:0000256|HAMAP-Rule:MF_01343}.; FUNCTION: One of the primary rRNA binding proteins, it binds directly to 16S rRNA where it helps nucleate assembly of the platform of the 30S subunit by binding and bridging several RNA helices of the 16S rRNA. {ECO:0000256|HAMAP-Rule:MF_01343, ECO:0000256|RuleBase:RU004524}. Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpsO Gene names (synonym): Mass: 10,505 Subunit structure [CC]: SUBUNIT: Part of the 30S ribosomal subunit. Forms a bridge to the 50S subunit in the 70S ribosome, contacting the 23S rRNA. {ECO:0000256|HAMAP-Rule:MF_01343}. Gene ontology (GO): ribosome [GO:0005840]; rRNA binding [GO:0019843]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0005840; GO:0006412; GO:0019843 Chain: Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein S15P family. {ECO:0000256|HAMAP-Rule:MF_01343, ECO:0000256|RuleBase:RU003919}. Protein families: Ribosomal protein S15P family Coiled coil: Domain [FT]: Motif: Region: EMBL: CP006916 ProteinModelPortal: A0A0F6CJY3 MEROPS: EnsemblBacteria KO: AHB99405 UniPathway: K02956 CDD: Gene3D: cd00353 HAMAP: 1.10.287.10 InterPro: MF_01343_B PANTHER: IPR000589;IPR005290;IPR009068 PIRSF: PRINTS: PROSITE: Pfam: PS00362 ProDom: PF00312 SMART: SUPFAM: SM01387 TIGRFAMs: SSF47060 96697-96970(+) >nucleotide sequence GATGTTGGCAGTGTTTTTGTTCAAGTAGCTGTTTTAACAGAAGAAATTAAGTTATTAACA GAACACCTACTTAAAAACAAAAAGGACTTCATTTCAAAGCGCGGTCTTTATACGAAAGTT TCAAAACGCAAGAATCTGTTAAATTATTTAAAACAAAACGATTTGAACGCTTATAGAAAC TTGATTTCAGAACTAGAATTAAGACATTCTTAA >protein sequence SKRKNLLNYLKQNDLNAYRNLISELELRHS |
© Fisunov Lab of Proteomics, 2016.