GCW_01505
![]() ![]() ![]() |
Uniprot: A0A0F6CLM3
Description: hypothetical protein EC number: Annotation score: 1 out of 5 Miscellaneous [CC]: Protein existence: Predicted Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): Gene names (synonym): Mass: 4,536 Subunit structure [CC]: Gene ontology (GO): Gene ontology IDs: Chain: Signal peptide: Domain [CC]: Sequence similarities: Protein families: Coiled coil: Domain [FT]: DOMAIN 1 24 EFG_C. {ECO:0000259|Pfam:PF00679}. Motif: Region: EMBL: CP006916 ProteinModelPortal: MEROPS: EnsemblBacteria KO: AHB99995 UniPathway: CDD: Gene3D: HAMAP: 3.30.70.240 InterPro: PANTHER: IPR009022;IPR000640 PIRSF: PRINTS: PROSITE: Pfam: ProDom: PF00679 SMART: SUPFAM: TIGRFAMs: SSF54980 355679-355796(+) >nucleotide sequence AGCATTGCTGATCCATTCATTAAACGTAGAAACATTCAAGACAAAGACGAAGATTAA >protein sequence |
© Fisunov Lab of Proteomics, 2016.