GCW_02545
![]() ![]() ![]() |
Uniprot: A0A0F6CKU2
Description: 50S ribosomal protein L33 EC number: Annotation score: 1 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpmG Gene names (synonym): Mass: 6,184 Subunit structure [CC]: Gene ontology (GO): ribosome [GO:0005840]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0005840; GO:0006412 Chain: Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein L33P family. {ECO:0000256|HAMAP-Rule:MF_00294}. Protein families: Ribosomal protein L33P family Coiled coil: Domain [FT]: Motif: Region: EMBL: CP006916 ProteinModelPortal: A0A0F6CKU2 MEROPS: EnsemblBacteria KO: AHB99714 UniPathway: K02913 CDD: Gene3D: HAMAP: InterPro: MF_00294 PANTHER: IPR001705;IPR018264;IPR011332 PIRSF: PRINTS: PROSITE: Pfam: PS00582 ProDom: PF00471 SMART: SUPFAM: TIGRFAMs: SSF57829 605954-606116(-) >nucleotide sequence TAGACTTAGTTTTTCTGGGTTTTTTTTTGCATTCTTTCTAGTAATGTAATTAATTTCATT ACAGTCATTGCAACCTAATCTGGTACCACGTTTTTGTGCCAT >protein sequence |
© Fisunov Lab of Proteomics, 2016.