GCW_02630
![]() ![]() ![]() |
Uniprot: A0A0F6CKV4
Description: preprotein translocase subunit SecG EC number: Annotation score: 1 out of 5 Miscellaneous [CC]: Protein existence: Predicted Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): secG Gene names (synonym): Mass: 8,451 Subunit structure [CC]: Gene ontology (GO): integral component of membrane [GO:0016021]; P-P-bond-hydrolysis-driven protein transmembrane transporter activity [GO:0015450]; protein secretion [GO:0009306] Gene ontology IDs: GO:0009306; GO:0015450; GO:0016021 Chain: Signal peptide: Domain [CC]: Sequence similarities: Protein families: Coiled coil: Domain [FT]: Motif: Region: EMBL: CP006916 ProteinModelPortal: MEROPS: EnsemblBacteria KO: AHB99726 UniPathway: K03075 CDD: Gene3D: HAMAP: InterPro: PANTHER: IPR004692 PIRSF: PRINTS: PROSITE: Pfam: ProDom: SMART: SUPFAM: TIGRFAMs: In one protein complex with GCW_03635 GCW_00375 623386-623620(-) >nucleotide sequence CATCACGATCTGTAAGATCTTAATAATCCCACGGTCTTTGGTCTTTTTAAAGATCTCAAG ATCTTGTCCAGATAATGAAGCTAAGCCACCAGTTGTCCCAGAGTTAGACAGCCCCAGTCC GACGATTAAAGCGATGATTGCTAGTATAAAAAATGTTATTTCAGTTGGATTCAT >protein sequence LMLLFLILGLIYHFVIK |
© Fisunov Lab of Proteomics, 2016.