GCW_03010
![]() ![]() ![]() |
Uniprot: A0A0F6CL20
Description: 50S ribosomal protein L28 EC number: Annotation score: 1 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpmB Gene names (synonym): Mass: 7,237 Subunit structure [CC]: Gene ontology (GO): ribosome [GO:0005840]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0005840; GO:0006412 Chain: Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein L28P family. {ECO:0000256|HAMAP-Rule:MF_00373}. Protein families: Ribosomal protein L28P family Coiled coil: Domain [FT]: Motif: Region: EMBL: CP006916 ProteinModelPortal: MEROPS: EnsemblBacteria KO: AHB99792 UniPathway: K02902 CDD: Gene3D: HAMAP: InterPro: MF_00373 PANTHER: IPR026569;IPR001383 PIRSF: PRINTS: PROSITE: Pfam: ProDom: PF00830 SMART: SUPFAM: TIGRFAMs: 717975-718170(-) >nucleotide sequence TAATGTACCACGATCAGTTTTTACTTTAACTTTTTGTAGGTTTAAGTTTCAACGACGCTT GGTAATGTTTAAAGCATGAGAACGATTATTTCCTGCTAAAGGACCAAGCCCGGTTAGATC ATCTCTACGAGCCAT >protein sequence DLLA |
© Fisunov Lab of Proteomics, 2016.