GCW_03340
![]() ![]() ![]() |
Uniprot: A0A0F6CLQ3
Description: hypothetical protein EC number: Annotation score: 1 out of 5 Miscellaneous [CC]: Protein existence: Predicted Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): Gene names (synonym): Mass: 7,384 Subunit structure [CC]: Gene ontology (GO): oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor [GO:0016620] Gene ontology IDs: GO:0016620 Chain: Signal peptide: Domain [CC]: Sequence similarities: Protein families: Coiled coil: Domain [FT]: DOMAIN 3 65 Gp_dh_N. {ECO:0000259|SMART:SM00846}. Motif: Region: EMBL: CP006916 ProteinModelPortal: MEROPS: EnsemblBacteria KO: AHC00026 UniPathway: K00134 CDD: Gene3D: HAMAP: 3.40.50.720 InterPro: PANTHER: IPR020831;IPR020828;IPR016040 PIRSF: PTHR10836 PRINTS: PROSITE: Pfam: ProDom: PF00044 SMART: SUPFAM: SM00846 TIGRFAMs: SSF51735 801410-801608(-) >nucleotide sequence GTGAGCTAGAGTTTCAGCATCAGTTAAATCATTAACTGATACCACTTCTACTTTGTCTAT AAGGCTTGTTTCTAGCATTCTACGTGATACTAGACGGCCAATTCTATCAAAACCATTGAT AGCTATTTTCTTTTTCAT >protein sequence IKSPH |
© Fisunov Lab of Proteomics, 2016.