GCW_03545
![]() ![]() ![]() |
Uniprot: A0A0F6CLB4
Description: 50S ribosomal protein L36 EC number: Annotation score: 1 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpmJ Gene names (synonym): Mass: 4,390 Subunit structure [CC]: Gene ontology (GO): ribosome [GO:0005840]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0005840; GO:0006412 Chain: Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein L36P family. {ECO:0000256|HAMAP-Rule:MF_00251, ECO:0000256|RuleBase:RU000571}. Protein families: Ribosomal protein L36P family Coiled coil: Domain [FT]: Motif: Region: EMBL: CP006916 ProteinModelPortal: A0A0F6CLB4 MEROPS: EnsemblBacteria KO: AHB99886 UniPathway: K02919 CDD: Gene3D: HAMAP: InterPro: MF_00251 PANTHER: IPR000473 PIRSF: PTHR18804 PRINTS: PROSITE: Pfam: PS00828 ProDom: PF00444 SMART: SUPFAM: TIGRFAMs: SSF57840 849986-850100(-) >nucleotide sequence TCTAATAACTTTGCAATCTTTGCAAATTGGTTTTACCGATGATCTTACTTTCAT >protein sequence |
© Fisunov Lab of Proteomics, 2016.