GCW_92117
![]() ![]() ![]() |
Uniprot: A0A0F6CLY8
Description: Acyl dehydratase EC number: Annotation score: 1 out of 5 Miscellaneous [CC]: Protein existence: Predicted Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): Gene names (synonym): Mass: 4,731 Subunit structure [CC]: Gene ontology (GO): integral component of membrane [GO:0016021] Gene ontology IDs: GO:0016021 Chain: Signal peptide: Domain [CC]: Sequence similarities: Protein families: Coiled coil: Domain [FT]: Motif: Region: EMBL: CP006916 ProteinModelPortal: MEROPS: EnsemblBacteria KO: AHV85440 UniPathway: K18290 CDD: Gene3D: HAMAP: 3.10.129.10 InterPro: PANTHER: IPR029069 PIRSF: PRINTS: PROSITE: Pfam: ProDom: SMART: SUPFAM: TIGRFAMs: SSF54637 500410-500539(+) >nucleotide sequence ACATTTATATTAGCTCTTGCAACAGGGATGTCAGTAAACTCTATTAGTGGTAAGGTTGTG CTAATCTAA >protein sequence |
© Fisunov Lab of Proteomics, 2016.