SPM_000185
  | Uniprot: A0A037UM70
Description: 50S ribosomal protein L32 EC number: Annotation score: 1 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpmF Gene names (synonym): Mass: 6,720 Subunit structure [CC]: Gene ontology (GO): large ribosomal subunit [GO:0015934]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0006412; GO:0015934 Chain: Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein L32P family. {ECO:0000256|HAMAP-Rule:MF_00340}. Protein families: Ribosomal protein L32P family Coiled coil: Domain [FT]: Motif: Region: EMBL: AGBZ02000001 ProteinModelPortal: MEROPS: EnsemblBacteria KO: KAI92537 UniPathway: CDD: Gene3D: HAMAP: InterPro: MF_00340 PANTHER: IPR002677;IPR011332 PIRSF: PRINTS: PROSITE: Pfam: ProDom: PF01783 SMART: SUPFAM: TIGRFAMs: SSF57829 |
33045-33222(-) >nucleotide sequence TGGCTTAATTAATGCTCCACAATTTTTACATGCTATCAAAGTTGCTCCAACTAATTTAAA ATGTGTTCGGCGTTTTCTTTTTGCCTGCTTGGATGTTTTTCGAAATGGTACCGCCAT >protein sequence |
© Fisunov Lab of Proteomics, 2016.