SPM_003525
  | Uniprot: A0A037UNU1
Description: 30S ribosomal protein S15 EC number: Annotation score: 2 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: FUNCTION: Forms an intersubunit bridge (bridge B4) with the 23S rRNA of the 50S subunit in the ribosome. {ECO:0000256|HAMAP-Rule:MF_01343}.; FUNCTION: One of the primary rRNA binding proteins, it binds directly to 16S rRNA where it helps nucleate assembly of the platform of the 30S subunit by binding and bridging several RNA helices of the 16S rRNA. {ECO:0000256|HAMAP-Rule:MF_01343, ECO:0000256|RuleBase:RU004524}. Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): rpsO Gene names (synonym): Mass: 10,131 Subunit structure [CC]: SUBUNIT: Part of the 30S ribosomal subunit. Forms a bridge to the 50S subunit in the 70S ribosome, contacting the 23S rRNA. {ECO:0000256|HAMAP-Rule:MF_01343}. Gene ontology (GO): ribosome [GO:0005840]; rRNA binding [GO:0019843]; structural constituent of ribosome [GO:0003735]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0005840; GO:0006412; GO:0019843 Chain: Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein S15P family. {ECO:0000256|HAMAP-Rule:MF_01343, ECO:0000256|RuleBase:RU003919}. Protein families: Ribosomal protein S15P family Coiled coil: Domain [FT]: Motif: Region: EMBL: AGBZ02000001 ProteinModelPortal: MEROPS: EnsemblBacteria KO: KAI93047 UniPathway: CDD: Gene3D: cd00353 HAMAP: 1.10.287.10 InterPro: MF_01343_B PANTHER: IPR000589;IPR005290;IPR009068 PIRSF: PRINTS: PROSITE: Pfam: PS00362 ProDom: PF00312 SMART: SUPFAM: SM01387 TIGRFAMs: SSF47060 |
663932-664199(+) >nucleotide sequence ACTGGTTCAACAAAAGTTCAAATTGCAATTTTAACAGAAGATATTAATAATTTGACAGAA CACTTGAAAATACATCGAAAAGATATTGTTTCAAGAAGAAGTTTATTGCAAAAAGTAGCG CAAAGAAAACACTTGCTTGCATATTTAATTAAGACTAATTTTAATGAATATAAAGCAATC ATTGAAACATTGGGAATTAGAAAATAA >protein sequence QRKHLLAYLIKTNFNEYKAIIETLGIRK |
© Fisunov Lab of Proteomics, 2016.