SPM_004990
  | Uniprot: A0A037UQT8
Description: 30S ribosomal protein S14 EC number: Annotation score: 2 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: COFACTOR: Name=Zn(2+); Xref=ChEBI:CHEBI:29105; Evidence={ECO:0000256|HAMAP-Rule:MF_01364}; ; Note=Binds 1 zinc ion per subunit. {ECO:0000256|HAMAP-Rule:MF_01364} Enzyme regulation: Function [CC]: FUNCTION: Binds 16S rRNA, required for the assembly of 30S particles and may also be responsible for determining the conformation of the 16S rRNA at the A site. {ECO:0000256|HAMAP-Rule:MF_01364, ECO:0000256|SAAS:SAAS00014978}. Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: METAL 24 24 Zinc. {ECO:0000256|HAMAP-Rule:MF_01364}.; METAL 27 27 Zinc. {ECO:0000256|HAMAP-Rule:MF_01364}.; METAL 40 40 Zinc. {ECO:0000256|HAMAP-Rule:MF_01364}.; METAL 43 43 Zinc. {ECO:0000256|HAMAP-Rule:MF_01364}. Nucleotide binding: Site: Gene names (primary): rpsZ Gene names (synonym): rpsN Mass: 7,003 Subunit structure [CC]: SUBUNIT: Part of the 30S ribosomal subunit. Contacts proteins S3 and S10. {ECO:0000256|HAMAP-Rule:MF_01364, ECO:0000256|SAAS:SAAS00014992}. Gene ontology (GO): ribosome [GO:0005840]; rRNA binding [GO:0019843]; structural constituent of ribosome [GO:0003735]; zinc ion binding [GO:0008270]; translation [GO:0006412] Gene ontology IDs: GO:0003735; GO:0005840; GO:0006412; GO:0008270; GO:0019843 Chain: Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the ribosomal protein S14P family. Zinc-binding S14P subfamily. {ECO:0000256|HAMAP-Rule:MF_01364, ECO:0000256|SAAS:SAAS00540777}. Protein families: Ribosomal protein S14P family, Zinc-binding S14P subfamily Coiled coil: Domain [FT]: Motif: Region: EMBL: AGBZ02000004 ProteinModelPortal: MEROPS: EnsemblBacteria KO: KAI92095 UniPathway: CDD: Gene3D: HAMAP: InterPro: MF_01364_B PANTHER: IPR001209;IPR018271;IPR023053 PIRSF: PTHR19836 PRINTS: PROSITE: Pfam: PS00527 ProDom: PF00253 SMART: SUPFAM: TIGRFAMs: |
64477-64663(+) >nucleotide sequence TATACTCGATGTGGAAACTGTGGGCGACCTCATGCTGTGTTACGTAAATTTGATTTATGT CGTTTATGCTTTAGAAATTTAGCAAGTAAAGGACAAATTCCTGGGGTTAGAAAAGCTTCA TGATAG >protein sequence W |
© Fisunov Lab of Proteomics, 2016.