SPM_005030
  | Uniprot: A0A037UN89
Description: translation initiation factor IF-1 EC number: Annotation score: 2 out of 5 Miscellaneous [CC]: Protein existence: Inferred from homology Catalytic activity: Cofactor: Enzyme regulation: Function [CC]: FUNCTION: One of the essential components for the initiation of protein synthesis. Stabilizes the binding of IF-2 and IF-3 on the 30S subunit to which N-formylmethionyl-tRNA(fMet) subsequently binds. Helps modulate mRNA selection, yielding the 30S pre-initiation complex (PIC). Upon addition of the 50S ribosomal subunit IF-1, IF-2 and IF-3 are released leaving the mature 70S translation initation complex. {ECO:0000256|HAMAP-Rule:MF_00075, ECO:0000256|SAAS:SAAS00571771}. Pathway: Active site: Binding site: Calcium binding: DNA binding: Metal binding: Nucleotide binding: Site: Gene names (primary): infA Gene names (synonym): Mass: 8,168 Subunit structure [CC]: SUBUNIT: Component of the 30S ribosomal translation pre-initiation complex which assembles on the 30S ribosome in the order IF-2 and IF-3, IF-1 and N-formylmethionyl-tRNA(fMet); mRNA recruitment can occur at any time during PIC assembly. {ECO:0000256|HAMAP-Rule:MF_00075, ECO:0000256|SAAS:SAAS00326798}. Gene ontology (GO): cytoplasm [GO:0005737]; ribosome binding [GO:0043022]; rRNA binding [GO:0019843]; translation initiation factor activity [GO:0003743] Gene ontology IDs: GO:0003743; GO:0005737; GO:0019843; GO:0043022 Chain: Signal peptide: Domain [CC]: Sequence similarities: SIMILARITY: Belongs to the IF-1 family. {ECO:0000256|HAMAP-Rule:MF_00075, ECO:0000256|SAAS:SAAS00571750}.; SIMILARITY: Contains 1 S1-like domain. {ECO:0000256|HAMAP-Rule:MF_00075, ECO:0000256|RuleBase:RU004366}. Protein families: IF-1 family Coiled coil: Domain [FT]: DOMAIN 1 72 S1-like. {ECO:0000259|PROSITE:PS50832}. Motif: Region: EMBL: AGBZ02000004 ProteinModelPortal: MEROPS: EnsemblBacteria KO: KAI92103 UniPathway: CDD: Gene3D: HAMAP: 2.40.50.140 InterPro: MF_00075 PANTHER: IPR012340;IPR006196;IPR022967;IPR004368 PIRSF: PRINTS: PROSITE: Pfam: PS50832 ProDom: PF01176 SMART: SUPFAM: SM00316 TIGRFAMs: SSF50249 |
69211-69430(+) >nucleotide sequence ATGTTTAAGGTGCAATTAGAAAATGGCGCAACTATTTTAGCTCACGTTTCGGGTAAAATC CGGATGAATTACATTCGCATTTTACCCGGCGATACAGTAGTTGTGGAAATGTCACCTTAT GACTTAGAACGTGGGCGTATTGTTTTTAGACATAAATAA >protein sequence DLERGRIVFRHK |
© Fisunov Lab of Proteomics, 2016.